Scientia et Arte

If science were art and art were science, then the howling black wolf has probably swallowed some N-(4-hydroxyphenyl)ethanamide.

Case Study 4: A case of Vitamin E deficiency

Here is another case from Richard Ludueña’s Learning More Biochemistry: 100 New Case-Oriented Problems (1997):

Your patient is a 20-year-old wheelchair-bound man who exhibits an absence of deep tendon reflexes. The lipoprotein profile of your patient is normal as his absorption of dietary α-tocopherol (vitamin E). However, the VLDL (very low density lipoprotein) of your patient has significantly less α-tocopherol bound to it than you would expect in a normal individual. You sequence a portion of his DNA that codes for a certain protein. Part of the sequence is shown here, compared to that of a normal individual. The sequence begins at the beginning of a codon:

Normal person:                CAAATCACTCCATCCGTAGCCAAGAAGATTG

Your patient:                     CAAATCTCACTCCATCCGTAGCCAAGAAGATTG

This case is a review of the Central Dogma. We need to determine the protein sequence from the given DNA sequence.This would entail transforming DNA into RNA (change T into U), and using the standard genetic code to determine the protein coded by each codon.

Normal person:

DNA: CAA ATC ACT CCA TCC GTA GCC AAG AAG ATT G

RNA: CAA AUC ACU CCA UCC GUA GCC AAG AAG AUU G

Protein: Gln Ile Thr Pro Ser Val Ala Lys Lys Ile

Patient:

DNA: CAA ATC TCA CTC CAT CCG TAG CCA AGA AGA TTG

RNA: CAA AUC UCA CUC CAU CCG UAG CCA AGA AGA UUG

Protein: Gln Ile Leu Leu His Pro STOP

The addition of two nitrogen bases (see underlined in the DNA sequence) in the patient’s DNA caused a different set of codons, ultimately leading to the UAG (Stop) codon, and to the eventual premature termination of the protein.

The case mentions the inability of the patient to walk properly, indicating a neural damage. This indicate an effect of less vitamin E in the body, since the compound is an antioxidant that prevents damage to nerves.

File:Tocopherol, alpha-.svg

Vitamin E (α-tocopherol form)

This mutation leads to a protein defect. This protein is question is consequently involved in α-tocopherol (vitamin E) transfer. Vitamin E should be attached to VLDL (very low density lipoprotein).

The disorder is ataxia with isolated vitamin E deficiency. Ataxia is a term which describes lack of coordination, hence a neural problem. In this case, ataxia is a symptom of this deficiency of vitamin E. As indicated in this case, a lipoprotein profile, as well as measuremet of vitamin E plasma concentrations, could be possible tests for this disorder.

A possible, and simple, treatment that would prevent further deterioration is administering large doses of vitamin E into the patient.

The disorder is rare and could be inherited, much like the other two case studies mentioned. Since the “culprit” is the α-tocopherol transfer protein, there might be defects in the gene which encodes it. One possible mutation is shown in this case.

The National Center for Biotechnology Information, as part of its Gene Reviews, gives a profile of ataxia with vitamin E deficiency.

Main References

Ludueña, R. F. Learning More Biochemistry: 100 New Case-Oriented Problems, Problem 8, Wiley-Liss, Inc. (1997)

Image Sources

http://upload.wikimedia.org/wikipedia/commons/a/ad/Tocopherol%2C_alpha-.svg

[post by Ajep Perez]

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

Information

This entry was posted on October 1, 2012 by in Case Studies and tagged , , .
%d bloggers like this: